Top » Catalog » R1b » A3

$18.00

A3
[A3]

A3
hg38 Position: ChrY:8704499..8704499
Ancestral: G
Derived: A
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1b1b1a1
Comments: Found in a R1b-L513 person
Forward Primer: A3_F GCTCACCTGAAGGAAACAGC
Reverse Primer: A3_R CCATTACAGCCACCAAAAGG
Reviews

Customers who bought this product also purchased
FGC32805
FGC32805
DYS572
DYS572
DYS607
DYS607
Z23507
Z23507
Z16340
Z16340
Z39589
Z39589
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A486
1 x A1483
1 x A380
$54.00
Haplogroup Info
Other products
Currencies