Top » Catalog » R1b » A890

$18.00

A890
[A890]

A890
hg38 Position: ChrY:2914550..2914550
Ancestral: C
Derived: T
Reference: Maynard (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream or equivalent L701
Forward Primer: A890_F TGGTTCACCTCAAGGAACTAGG
Reverse Primer: A890_R TTGGAAGTATTCCCTCCTCTTC
Reviews

Customers who bought this product also purchased
A907
A907
L701
L701
FGC5494
FGC5494
A894
A894
A902
A902
A909
A909
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies