Top » Catalog » R1b » A891

$19.00

A891
[A891]

A891
hg38 Position: ChrY:7725777..7725777
Ancestral: C
Derived: A
Reference: Maynard (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream or equivalent L701
Forward Primer: A891_F CCGTAGGCTATTCCAGATGC
Reverse Primer: A891_R GAAAGGCCCTTGGTTGTG
Reviews

Customers who bought this product also purchased
A893
A893
A900
A900
A908
A908
A890
A890
A899
A899
A906
A906
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies