Top » Catalog » R1b » A891

$18.00

A891
[A891]

A891
hg38 Position: ChrY:7725777..7725777
Ancestral: C
Derived: A
Reference: Maynard (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream or equivalent L701
Forward Primer: A891_F CCGTAGGCTATTCCAGATGC
Reverse Primer: A891_R GAAAGGCCCTTGGTTGTG
Reviews

Customers who bought this product also purchased
A897
A897
A912
A912
A896
A896
A903
A903
A911
A911
A894
A894
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A635
1 x A677
1 x A2127
1 x A104
1 x A952
1 x A966
1 x A800
1 x A183
1 x A2156
1 x A1229
1 x A47
1 x A561
1 x A1039
1 x A1295
1 x A1225
1 x A2252
1 x A1262
1 x A478
1 x A1257
1 x A1737
$360.00
Haplogroup Info
Other products
Currencies