Top » Catalog » R1b » A893

$18.00

A893
[A893]

A893
hg38 Position: ChrY:8111031..8111031
Ancestral: A
Derived: C
Reference: Maynard (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream or equivalent L701
Forward Primer: A893_F CAGCTCCTGAAGAAGTTTAGTAGCA
Reverse Primer: A893_R TGGATTATTACAGCACAAAGATCAC
Reviews

Customers who bought this product also purchased
A898
A898
A904
A904
A897
A897
A912
A912
A896
A896
A903
A903
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies