Top » Catalog » R1b » A894

$18.00

A894
[A894]

A894
hg38 Position: ChrY:8661735..8661735
Ancestral: T
Derived: C
Reference: Maynard (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream or equivalent L701
Forward Primer: A894_F CTGAGAGCAAAGCGGACTTC
Reverse Primer: A894_R ACGACAAAGCCAAGTCCAAC
Reviews

Customers who bought this product also purchased
A906
A906
A892
A892
A898
A898
A904
A904
A897
A897
A912
A912
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies