Top » Catalog » R1b » A894

$18.00

A894
[A894]

A894
hg38 Position: ChrY:8661735..8661735
Ancestral: T
Derived: C
Reference: Maynard (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream or equivalent L701
Forward Primer: A894_F CTGAGAGCAAAGCGGACTTC
Reverse Primer: A894_R ACGACAAAGCCAAGTCCAAC
Reviews

Customers who bought this product also purchased
A891
A891
A900
A900
A908
A908
A890
A890
A899
A899
A906
A906
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2263
1 x A500
1 x A698
1 x A1168
1 x A2242
1 x A877
1 x A1271
1 x A449
1 x A177
1 x A1270
1 x A223
1 x A819
1 x A982
1 x A1367
1 x A2147
1 x A2140
1 x A2135
$306.00
Haplogroup Info
Other products
Currencies