Top » Catalog » R1b » A896

$18.00

A896
[A896]

A896
hg38 Position: ChrY:12198618..12198618
Ancestral: C
Derived: G
Reference: Maynard (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream or equivalent L701
Forward Primer: A896_F GATAGTCTATGTCCCTAGTCCCCTG
Reverse Primer: A896_R GGTTGCAGTGAGCCAACG
Reviews

Customers who bought this product also purchased
A911
A911
A893
A893
A902
A902
A909
A909
A891
A891
A900
A900
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies