Top » Catalog » R1b » A896

$18.00

A896
[A896]

A896
hg38 Position: ChrY:12198618..12198618
Ancestral: C
Derived: G
Reference: Maynard (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream or equivalent L701
Forward Primer: A896_F GATAGTCTATGTCCCTAGTCCCCTG
Reverse Primer: A896_R GGTTGCAGTGAGCCAACG
Reviews

Customers who bought this product also purchased
A890
A890
A899
A899
A906
A906
A892
A892
A898
A898
A904
A904
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A306
1 x A1773
1 x A187
1 x A551
1 x A95
1 x A1322
1 x A410
1 x A975
1 x A135
1 x A359
1 x A510
1 x A337
1 x A629
1 x A467
1 x A1165
1 x A1161
1 x A462
1 x A1495
1 x A927
1 x A1269
1 x A1234
1 x A2141
$396.00
Haplogroup Info
Other products
Currencies