Top » Catalog » R1b » A898

$18.00

A898
[A898]

A898
hg38 Position: ChrY:14128470..14128470
Ancestral: A
Derived: G
Reference: Maynard (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream or equivalent L701
Forward Primer: A898v2_F CACCATGATTTTGGGACCTG
Reverse Primer: A898v2_R CTTAAGTTCAAAATTCCACAATTCTG
Reviews

Customers who bought this product also purchased
A897
A897
A912
A912
A894
A894
A903
A903
A911
A911
A893
A893
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies