Top » Catalog » R1b » A899

$19.00

A899
[A899]

A899
hg38 Position: ChrY:15865559..15865559
Ancestral: T
Derived: C
Reference: Maynard (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream or equivalent L701
Forward Primer: A899_F CCAATTTTCCTTGCTTGGTG
Reverse Primer: A899_R ATGCCAGGACATCTTGCAG
Reviews

Customers who bought this product also purchased
A909
A909
A891
A891
A900
A900
A908
A908
A890
A890
A898
A898
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies