Top » Catalog » R1b » A900

$18.00

A900
[A900]

A900
hg38 Position: ChrY:16802671..16802671
Ancestral: T
Derived: A
Reference: Maynard (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream or equivalent L701
Forward Primer: A900_F TTTTGCAAAGTTAGGTGCAAAC
Reverse Primer: A900_R AAGAAGTTGGTTGCTGCATAGAG
Reviews

Customers who bought this product also purchased
A911
A911
A893
A893
A902
A902
A909
A909
A891
A891
A899
A899
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1343
1 x A1234
1 x A1049
1 x A714
1 x A337
$90.00
Haplogroup Info
Other products
Currencies