Top » Catalog » R1b » A902

$18.00

A902
[A902]

A902
hg38 Position: ChrY:17332733..17332733
Ancestral: A
Derived: G
Reference: Maynard (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream or equivalent L701
Forward Primer: A902_F TTATCTCCTTGTTATTCTCTGCAGC
Reverse Primer: A902_R CCACTTGTTCCCCAAGTTCC
Reviews

Customers who bought this product also purchased
A893
A893
A900
A900
A909
A909
A891
A891
A899
A899
A908
A908
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies