Top » Catalog » R1b » A902

$18.00

A902
[A902]

A902
hg38 Position: ChrY:17332733..17332733
Ancestral: A
Derived: G
Reference: Maynard (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream or equivalent L701
Forward Primer: A902_F TTATCTCCTTGTTATTCTCTGCAGC
Reverse Primer: A902_R CCACTTGTTCCCCAAGTTCC
Reviews

Customers who bought this product also purchased
A896
A896
A904
A904
A897
A897
A912
A912
A894
A894
A903
A903
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2203
1 x A8
1 x A364
1 x A2209
1 x A1241
$90.00
Haplogroup Info
Other products
Currencies