Top » Catalog » R1b » A904

$18.00

A904
[A904]

A904
hg38 Position: ChrY:19864387..19864392
Ancestral: ins
Derived: del
Reference: Maynard (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream or equivalent L701
Forward Primer: A904_F TCAAGGGTGCTTTAAGGGATAC
Reverse Primer: A904_R GCTCAGTGAGATCCATGAGAAAG
Reviews

Customers who bought this product also purchased
A897
A897
A912
A912
A894
A894
A902
A902
A911
A911
A893
A893
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2202
1 x A2240
$36.00
Haplogroup Info
Other products
Currencies