Top » Catalog » R1b » A906

$18.00

A906
[A906]

A906
hg38 Position: ChrY:21637253..21637253
Ancestral: T
Derived: C
Reference: Maynard (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream or equivalent L701
Forward Primer: A906_F AGCAGAGAGTGCCTCACAAAG
Reverse Primer: A906_R TGTCTGCTCAGGACAGAAGG
Reviews

Customers who bought this product also purchased
A894
A894
A902
A902
A911
A911
A893
A893
A900
A900
A909
A909
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies