Top » Catalog » R1b » A906

$18.00

A906
[A906]

A906
hg38 Position: ChrY:21637253..21637253
Ancestral: T
Derived: C
Reference: Maynard (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream or equivalent L701
Forward Primer: A906_F AGCAGAGAGTGCCTCACAAAG
Reverse Primer: A906_R TGTCTGCTCAGGACAGAAGG
Reviews

Customers who bought this product also purchased
A890
A890
A898
A898
A904
A904
A892
A892
A896
A896
A903
A903
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A761
1 x A142
1 x A654
1 x A2117
1 x A48
1 x A961
1 x A2183
1 x A858
1 x A1232
1 x A347
1 x A730
1 x A46
1 x A1197
1 x A898
1 x A2077
1 x A1251
$288.00
Haplogroup Info
Other products
Currencies