Top » Catalog » R1b » A908

$18.00

A908
[A908]

A908
hg38 Position: ChrY:14586583..14586583
Ancestral: G
Derived: A
Reference: Maynard (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream or equivalent L701
Forward Primer: A908_F AGCCAGGGTTGTGAAAAATG
Reverse Primer: A908_R CTGTTGCTAGGCTGGAATGC
Reviews

Customers who bought this product also purchased
A9010
A9010
A907
A907
A911
A911
A893
A893
A900
A900
A909
A909
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies