Top » Catalog » R1b » A911

$18.00

A911
[A911]

A911
hg38 Position: ChrY:21445806..21445806
Ancestral: C
Derived: T
Reference: Maynard (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Below FGC5494 > FGC33507 > A895
Forward Primer: A911_F ATCTGTGCACAGAGGCTGC
Reverse Primer: A911_R TTTACTTCAAACTGAGTTCATGGTG
Reviews

Customers who bought this product also purchased
A904
A904
A892
A892
A896
A896
A903
A903
A897
A897
A912
A912
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1092
$18.00
Haplogroup Info
Other products
Currencies