Top » Catalog » R1b » A911

$18.00

A911
[A911]

A911
hg38 Position: ChrY:21445806..21445806
Ancestral: C
Derived: T
Reference: Maynard (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Below FGC5494 > FGC33507 > A895
Forward Primer: A911_F ATCTGTGCACAGAGGCTGC
Reverse Primer: A911_R TTTACTTCAAACTGAGTTCATGGTG
Reviews

Customers who bought this product also purchased
A902
A902
A909
A909
A893
A893
A900
A900
A908
A908
A891
A891
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A67
$18.00
Haplogroup Info
Other products
Currencies