Top » Catalog » R1b » A912

$18.00

A912
[A912]

A912
hg38 Position: ChrY:7782745..7782745
Ancestral: T
Derived: C
Reference: Maynard (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream or equivalent L701
Forward Primer: A912_F ACCTTGTCTGGGAGTTGTGG
Reverse Primer: A912_R CTGGGGAGGTTGTGAGACAC
Reviews

Customers who bought this product also purchased
A903
A903
A897
A897
A911
A911
A894
A894
A902
A902
A909
A909
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A559
1 x A466
1 x A600
1 x A817
1 x A770
1 x A2118
1 x A1279
1 x A442
1 x A903
1 x A2133
1 x A90
1 x A949
1 x A1318
1 x A1770
1 x A935
$270.00
Haplogroup Info
Other products
Currencies