Top » Catalog » R1b » A912

$18.00

A912
[A912]

A912
hg38 Position: ChrY:7782745..7782745
Ancestral: T
Derived: C
Reference: Maynard (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream or equivalent L701
Forward Primer: A912_F ACCTTGTCTGGGAGTTGTGG
Reverse Primer: A912_R CTGGGGAGGTTGTGAGACAC
Reviews

Customers who bought this product also purchased
A899
A899
A906
A906
A890
A890
A898
A898
A904
A904
A892
A892
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies