Top » Catalog » R1b » A932

$18.00

A932
[A932]

A932
hg38 Position: ChrY:8656776..8656776
Ancestral: A
Derived: C
Reference: YSEQ (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g3 (not listed)
Comments: Downstream L1336
Forward Primer: A932_F CGCCTTGTGTTTTCATTGTG
Reverse Primer: A932_R AAACCCAGGATACCGTAGGC
Reviews

Customers who bought this product also purchased
DF49
DF49
FGC3903
FGC3903
DF13
DF13
Z255
Z255
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
L513
L513
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A447
1 x A250
1 x A441
1 x A671
1 x A579
1 x A1169
1 x A760
1 x A747
1 x A1491
1 x A1712
1 x A109
1 x A1224
1 x A162
1 x A983
$252.00
Haplogroup Info
Other products
Currencies