Top » Catalog » R1b » A941

$18.00

A941
[A941]

A941
hg38 Position: ChrY:14229975..14229975
Ancestral: A
Derived: G
Reference: YSEQ (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g5 (not listed)
Comments: Downstream S953
Forward Primer: A941_F TGGCCCCAAACTTAAAAGAAG
Reverse Primer: A941_R ACTCACCTCGGCCTCTCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies