Top » Catalog » R1b » A948

$18.00

A948
[A948]

A948
hg38 Position: ChrY:14841428..14841428
Ancestral: G
Derived: T
Reference: YSEQ (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g5 (not listed)
Comments: Downstream S953
Forward Primer: A948_F ATCCCTCTGCCCCTACTGC
Reverse Primer: A948_R GAGCCATCCATTGTGTAGCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1721
1 x A1036
1 x A1163
$54.00
Haplogroup Info
Other products
Currencies