Top » Catalog » R1b » A953

$18.00

A953
[A953]

A953
hg38 Position: ChrY:12712844..12712844
Ancestral: A
Derived: G
Reference: Larry W. Rodgers (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A953_F TTAGGCCATTGATATTGAAGGTG
Reverse Primer: A953_R GCATTCTAGCCTGGGTTGAC
Reviews

Customers who bought this product also purchased
S744
S744
A2120
A2120
R1b-L1335 Scots Panel
R1b-L1335 Scots Panel
CTS4931
CTS4931
PF5236
PF5236
S691
S691
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A761
1 x A142
1 x A654
1 x A2117
1 x A48
$90.00
Haplogroup Info
Other products
Currencies