Top » Catalog » R1b » A955

$18.00

A955
[A955]

A955
hg38 Position: ChrY:9260595..9260595
Ancestral: C
Derived: T
Reference: Joe Fox (2014)
ISOGG Haplogroup: R1b1a2a1a1c1a2a (not listed)
Comments: Below L1/S26
Forward Primer: A955_F AAGAACTGATGGCACAGAACG
Reverse Primer: A955_R GCTGCCCAGTCATTAAAACAC
Reviews

Customers who bought this product also purchased
A699
A699
S4272
S4272
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies