Top » Catalog » R1b » A958

$18.00

A958
[A958]

A958
hg38 Position: ChrY:20472907..20472907
Ancestral: A
Derived: C
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream of FGC13899
Forward Primer: A958_F CAGAGCCCAGATAGCCTCTG
Reverse Primer: A958_R AGGCCCATTTGAAAGTGTTTC
Reviews

Customers who bought this product also purchased
A980
A980
A240
A240
R1b-Z251 downstream 16
R1b-Z251 downstream 16
A979
A979
A237
A237
FGC13916
FGC13916
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies