Top » Catalog » R1b » A960

$18.00

A960
[A960]

A960
hg38 Position: ChrY:11904047..11904047
Ancestral: A
Derived: G
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream of A228
Forward Primer: A960_F TCACACACTTCTATAAAGCAGTTCAAG
Reverse Primer: A960_R CACATCCATCTACCAAGCTATCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A907
1 x A62
1 x A71
1 x A214
1 x A119
1 x A700
1 x A594
1 x A1066
1 x A1715
1 x A421
1 x A890
1 x A173
$216.00
Haplogroup Info
Other products
Currencies