Top » Catalog » R1b » A956

$19.00

A956
[A956]

A956
hg38 Position: ChrY:13853303..13853303
Ancestral: A
Derived: G
Reference: Nigel McCarthy (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a3
Comments: Downstream of A541
Forward Primer: A956_F CTAGCAGGAAATAGAACATGGACC
Reverse Primer: A956_R GAATGGAATAAGGAGAGAAATATGC
Reviews

Customers who bought this product also purchased
A12018
A12018
FGC27968
FGC27968
A12087
A12087
A9865
A9865
Z16254
Z16254
A9426
A9426
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies