Top » Catalog » R1b » A961

$18.00

A961
[A961]

A961
hg38 Position: ChrY:12006128..12006128
Ancestral: T
Derived: A
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream of A228
Forward Primer: A961_F AGATTCTTAGAACAAAGCCTGTCAC
Reverse Primer: A961_R CCACTCAAAGCCTAGTTTAATTGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies