Top » Catalog » R1b » A962

$18.00

A962
[A962]

A962
hg38 Position: ChrY:12313243..12313243
Ancestral: C
Derived: G
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream of A228
Forward Primer: A962_F GCGTCCAAAACTCCTGTAATAGC
Reverse Primer: A962_R CCTCAGGTGGAAACTGAAGAAG
Reviews

Customers who bought this product also purchased
A966
A966
A974
A974
A971
A971
A970
A970
A968
A968
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A531
1 x A591
$36.00
Haplogroup Info
Other products
Currencies