Top » Catalog » R1b » A965

$18.00

A965
[A965]

A965
hg38 Position: ChrY:12962289..12962289
Ancestral: A
Derived: G
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream of A228
Forward Primer: A965_F CTTTCTTTGGTGTGCAGAACTG
Reverse Primer: A965_R CTGTGAAGCCATAGTACCAAAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies