Top » Catalog » R1b » A965

$18.00

A965
[A965]

A965
hg38 Position: ChrY:12962289..12962289
Ancestral: A
Derived: G
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream of A228
Forward Primer: A965_F CTTTCTTTGGTGTGCAGAACTG
Reverse Primer: A965_R CTGTGAAGCCATAGTACCAAAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1147
1 x A909
1 x A1204
1 x A628
1 x A2190
1 x A679
1 x A580
1 x A656
1 x A904
1 x A801
1 x A469
1 x A184
1 x A92
1 x A518
1 x A1784
1 x A684
1 x A131
1 x A790
1 x A2130
$342.00
Haplogroup Info
Other products
Currencies