Top » Catalog » R1b » A966

$18.00

A966
[A966]

A966
hg38 Position: ChrY:14502612..14502612
Ancestral: T
Derived: C
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream of A228
Forward Primer: A966_F TGATTTCTGTATTAAATCCCTGGG
Reverse Primer: A966_R TTACAAGAGGGCTTGTTCAAGG
Reviews

Customers who bought this product also purchased
A970
A970
A968
A968
A962
A962
A974
A974
A971
A971
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A441
$18.00
Haplogroup Info
Other products
Currencies