Top » Catalog » R1b » A968

$18.00

A968
[A968]

A968
hg38 Position: ChrY:15830941..15830941
Ancestral: T
Derived: C
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream of A228 > A959
Forward Primer: A968v2_F AGAGAAAGAAAAAGAAGTTATTTTCCC
Reverse Primer: A968v2_R TAGTGCCACAACCTGGAGC
Reviews

Customers who bought this product also purchased
FGC13899
FGC13899
A964
A964
R1b-Z251 Panel (including 251-11EE subclades)
R1b-Z251 Panel (including 251-11EE subclades)
A959
A959
A241
A241
S11556
S11556
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A599
1 x A212
1 x A586
$54.00
Haplogroup Info
Other products
Currencies