Top » Catalog » R1b » A970

$18.00

A970
[A970]

A970
hg38 Position: ChrY:16528720..16528720
Ancestral: G
Derived: A
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream of A228
Forward Primer: A970_F CTCCTCCCAGTAGGCTGTTG
Reverse Primer: A970_R GGTATACAAATACTTATCACTGAGCTGC
Reviews

Customers who bought this product also purchased
A971
A971
A968
A968
A966
A966
A962
A962
A974
A974
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2206
$18.00
Haplogroup Info
Other products
Currencies