Top » Catalog » R1b » A971

$18.00

A971
[A971]

A971
hg38 Position: ChrY:19065680..19065680
Ancestral: C
Derived: T
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream of A228
Forward Primer: A971_F TTGGTAAATCTGTGAGCAGTGG
Reverse Primer: A971_R TCATAGCTGGGGCTGAAATC
Reviews

Customers who bought this product also purchased
A974
A974
A970
A970
A968
A968
A966
A966
A962
A962
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A411
1 x A478
1 x A2184
$54.00
Haplogroup Info
Other products
Currencies