Top » Catalog » R1b » A974

$18.00

A974
[A974]

A974
hg38 Position: ChrY:21284822..21284822
Ancestral: A
Derived: C
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream of A228
Forward Primer: A974_F CACCTATATTCTTGCAAATCACAAG
Reverse Primer: A974_R TTATCATATTACCCCAGTTAAAACGTC
Reviews

Customers who bought this product also purchased
A966
A966
A962
A962
A971
A971
A970
A970
A968
A968
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A640
1 x A1025
$36.00
Haplogroup Info
Other products
Currencies