Top » Catalog » R1b » A975

$18.00

A975
[A975]

A975
hg38 Position: ChrY:8740044..8740044
Ancestral: G
Derived: T
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream of A237
Forward Primer: A975_F GCAAGTCCAAATTGGAGAAGTAC
Reverse Primer: A975_R GCCAGGGATTTCCCAGAAG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
A959
A959
A233
A233
CTS9686
CTS9686
A958
A958
A980
A980
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A663
1 x A418
1 x A1010
1 x A791
1 x A558
1 x A1231
1 x A2160
1 x A714
1 x A958
1 x A604
1 x A304
1 x A778
1 x A788
1 x A743
1 x A649
1 x A44
$288.00
Haplogroup Info
Other products
Currencies