Top » Catalog » R1b » A976

$18.00

A976
[A976]

A976
hg38 Position: ChrY:12885446..12885446
Ancestral: G
Derived: A
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream of A237
Forward Primer: A976v2_F ATCCAATTTGTTGGCAAAGG
Reverse Primer: A976v2_R TGAGGCAGAAACAGAAAATTG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
A958
A958
A980
A980
A240
A240
R1b-Z251 downstream 16
R1b-Z251 downstream 16
A979
A979
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A948
$18.00
Haplogroup Info
Other products
Currencies