Top » Catalog » R1b » A977

$18.00

A977
[A977]

A977
hg38 Position: ChrY:16140029..16140029
Ancestral: C
Derived: A
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream of A237
Forward Primer: A977_F GTATGGGCCCTCTGTGACC
Reverse Primer: A977_R GTGCTTGGGTATCAAGCATGTAC
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
FGC13899
FGC13899
A959
A959
A233
A233
CTS9686
CTS9686
A958
A958
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A980
1 x A530
1 x A274
1 x A1263
1 x A883
1 x A275
1 x A252
1 x A598
1 x A511
1 x A2157
1 x A60
1 x A260
1 x A318
1 x A612
1 x A1073
1 x A2245
1 x A851
1 x A43
1 x A129
1 x A465
1 x A984
$378.00
Haplogroup Info
Other products
Currencies