Top » Catalog » R1b » A877

$18.00

A877
[A877]

A877
hg38 Position: ChrY:9994962..9994962
Ancestral: G
Derived: A
Reference: Wayne Kauffman (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of CTS2509
Forward Primer: A877_F ATTTGTGGCAAATCGAACG
Reverse Primer: A877_R GAATTTCCTGTGCTAATGAGAGG
Reviews

Customers who bought this product also purchased
A882
A882
A880
A880
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies