Top » Catalog » R1b » A982

$18.00

A982
[A982]

A982
hg38 Position: ChrY:13271739..13271739
Ancestral: A
Derived: G
Reference: Iain Kennedy (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Below A223
Forward Primer: A982_F AAATCCTGGGCCTGAGTTTC
Reverse Primer: A982_R ATGGACCCCTTCTGTCTTTG
Reviews

Customers who bought this product also purchased
A984
A984
A983
A983
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies