Top » Catalog » R1b » A983

$18.00

A983
[A983]

A983
hg38 Position: ChrY:19329672..19329672
Ancestral: T
Derived: A
Reference: Iain Kennedy (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Below A223
Forward Primer: A983_F ATCATCCTGCCATTTTAGCC
Reverse Primer: A983_R TACCACCTGGGACCATTTTC
Reviews

Customers who bought this product also purchased
A984
A984
A982
A982
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A197
1 x A2116
1 x A363
1 x A2216
1 x A54
1 x A101
1 x A2150
1 x A1030
$144.00
Haplogroup Info
Other products
Currencies