Top » Catalog » R1b » A986

$18.00

A986
[A986]

A986
hg38 Position: ChrY:14600021..14600021
Ancestral: A
Derived: G
Reference: Paul Roche (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A986_F CCTGAACCTAAGCAGCTTAATACC
Reverse Primer: A986_R AACATTATTCATAGGAGCTTAATAGCC
Reviews

Customers who bought this product also purchased
A993
A993
A987
A987
A992
A992
A998
A998
A985
A985
A991
A991
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies