Top » Catalog » R1b » A988

$18.00

A988
[A988]

A988
hg38 Position: ChrY:20765705..20765705
Ancestral: A
Derived: G
Reference: Paul Roche (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A988_F TGGATAGTTACTGAGTGTCATCTGTG
Reverse Primer: A988_R CCACTTTTCACATACATCCTGTGTAG
Reviews

Customers who bought this product also purchased
A991
A991
A997
A997
A990
A990
A996
A996
A989
A989
A995
A995
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A129
1 x A243
$36.00
Haplogroup Info
Other products
Currencies