Top » Catalog » R1b » A991

$18.00

A991
[A991]

A991
hg38 Position: ChrY:8543404..8543404
Ancestral: C
Derived: A
Reference: Paul Roche (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A991_F CCCCTTAGAACTAATAATCACCAATTC
Reverse Primer: A991_R AGAGTGCCACTCAATAACTGTGTC
Reviews

Customers who bought this product also purchased
A993
A993
A986
A986
A992
A992
A998
A998
A985
A985
A990
A990
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A208
$18.00
Haplogroup Info
Other products
Currencies