Top » Catalog » R1b » A992

$18.00

A992
[A992]

A992
hg38 Position: ChrY:14648915..14648915
Ancestral: G
Derived: C
Reference: Paul Roche (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A992_F AGGGAGAATGATTTGAGCTCTG
Reverse Primer: A992_R TCTTGCTCTGTTGCTCAGTCC
Reviews

Customers who bought this product also purchased
A998
A998
A985
A985
A990
A990
A997
A997
A989
A989
A996
A996
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies