Top » Catalog » R1b » A993

$18.00

A993
[A993]

A993
hg38 Position: ChrY:8141857..8141857
Ancestral: G
Derived: A
Reference: Paul Roche (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A993v2_F AAAAGTAAATATTGGCCATCACTAGG
Reverse Primer: A993v2_R CGTTTTTAATTGTTAAAAACTAGTTGGC
Reviews

Customers who bought this product also purchased
BY12505
BY12505
DF96
DF96
S15663
S15663
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
S1812
S1812
BY35163
BY35163
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies