Top » Catalog » R1b » A993

$18.00

A993
[A993]

A993
hg38 Position: ChrY:8141857..8141857
Ancestral: G
Derived: A
Reference: Paul Roche (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A993v2_F AAAAGTAAATATTGGCCATCACTAGG
Reverse Primer: A993v2_R CGTTTTTAATTGTTAAAAACTAGTTGGC
Reviews

Customers who bought this product also purchased
FGC8383
FGC8383
S11515
S11515
FGC13167
FGC13167
FGC13326
FGC13326
BY12505
BY12505
DF96
DF96
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A197
1 x A2116
1 x A363
1 x A2216
1 x A54
1 x A101
1 x A2150
1 x A1030
1 x A1071
1 x A1319
1 x A2186
1 x A882
1 x A103
1 x A627
1 x A2187
1 x A874
1 x A823
1 x A2224
1 x A892
1 x A286
$360.00
Haplogroup Info
Other products
Currencies