Top » Catalog » R1b » A994

$18.00

A994
[A994]

A994
hg38 Position: ChrY:8626438..8626438
Ancestral: G
Derived: C
Reference: Paul Roche (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A994_F GCATGATTCCCTTAGAGTGAGAAC
Reverse Primer: A994_R GTGTTGTCGAGGGGGACTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2154
1 x A1489
1 x A2269
1 x A1703
1 x A2233
1 x A1772
$108.00
Haplogroup Info
Other products
Currencies